sRNAbench Results for job ID: UBNMV10I6X5S169
The results will be stored for 15 days (This will be removed on: Thu 07 Jun 2018).
If you use the sRNAbench webserver plese check How to Cite.
Download all results as zip file here
adapter: TGGAATTCTCGGGTGCCAAGG
input: /opt/sRNAtoolbox/sRNAtoolboxweb/upload/UBNMV10I6X5S169/IK_exosomes.fastq.gz
minRC: 2
solid: false
dbPath: /opt/sRNAtoolboxDB
noMM: 2
bedGraph: true
adapterMM: 1
writeGenomeDist: true
mBowtie: 10
output: /opt/sRNAtoolbox/sRNAtoolboxweb/upload/UBNMV10I6X5S169
seed: 20
minReadLength: 15
plotMiR: true
kingdom: animal
guessAdapter: false
removeBarcode: 0
microRNA: hsa
recursiveAdapterTrimming: false
adapterMinLength: 10
species: GRCh38_p10_mp
alignType: n
isoMiR: true
tRNA: GRCh38_p10_genomic_tRNA.fa
maintainOrig: true
Preprocessing results
- Quality filtered:
- 328258 (5.29%)
- Adapter trimmed
- 6114811 (98.58%)
- Reads in analysis:
- 4328932 (69.79%)
- Length filtered (min):
- 1457621 (23.5%)
- Raw reads:
- 6203008
Read Length Distribution of Raw Input Reads
Read Length Distribution of Reads in Analysis
Genome/Library mapping results
- Genome mapped reads:
- 3762644(60.66%)
Graphical Summary
MiR profiling results
- Reads mapped to miRNAs:
- 633248 (18.13%)
- Reads mapped to miRBase hairpins:
- 327 (0.01%)
- Detected mature miR:
- 523 (19.69%)
- Detected hairpin miR:
- 369 (19.25%)
- MicroRNA details:
- isomiR details:
Genomic tRNA database
- Mapped reads in sense direction:
- 222657(6.37%)
- multiple assignment (MA)
- single assignment (SA)
- Mapped reads in antisense direction:
- 575(0.02%)
- MA antisense
- SA antisense
yRNAs
- Mapped reads in sense direction:
- 1473245(42.17%)
- multiple assignment (MA)
- single assignment (SA)
- Mapped reads in antisense direction:
- 2(0.0%)
- MA antisense
- SA antisense
vault RNAs
- Mapped reads in sense direction:
- 7664(0.22%)
- multiple assignment (MA)
- single assignment (SA)
- Mapped reads in antisense direction:
- 4(0.0%)
- MA antisense
- SA antisense
Ensembl release 91 (ncRNA)
- Mapped reads in sense direction:
- 309345(8.85%)
- multiple assignment (MA)
- single assignment (SA)
- Mapped reads in antisense direction:
- 142614(4.08%)
- MA antisense
- SA antisense
RNAcentral database 7.0
- Mapped reads in sense direction:
- 470450(13.47%)
- multiple assignment (MA)
- single assignment (SA)
- Mapped reads in antisense direction:
- 7013(0.2%)
- MA antisense
- SA antisense
Ensembl release 91 (cDNA)
- Mapped reads in sense direction:
- 106419(3.05%)
- multiple assignment (MA)
- single assignment (SA)
- Mapped reads in antisense direction:
- 120009(3.44%)
- MA antisense
- SA antisense
- tRNA anticodon statistic:
- details